circad | circRNAs associated with diseases

circMTO1
Gene	MTO1	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	30551873
Experimental Method
Sample Type	Tissue and cell lines	Comparison	One hundred and seventeen bladder cancer tissues and the matched adjacent tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCATCAGAGGCTTGGAGAA Reverse AAGGAAGGGGTGATCTGACG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, Y, Wan, B, Liu, L, Zhou, L, Zeng, Q (2019). Circular RNA circMTO1 suppresses bladder cancer metastasis by sponging miR-221 and inhibiting epithelial-to-mesenchymal transition. Biochem. Biophys. Res. Commun., 508, 4:991-996.